View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14507_high_14 (Length: 266)
Name: NF14507_high_14
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14507_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 21652369 - 21652614
Alignment:
| Q |
1 |
tgagaaaccgggctggtgtggtagtccagatttgcctccttgtgccgcgtatggtctttcttcttccttgatgcaaattttaaatgtaacttaacttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21652369 |
tgagaaaccgggctggtgtggtagtccagatttgcctccttgtgccgcgtatggtctttcttcttccttgatgcaaattttaaatgtaacttaacttttt |
21652468 |
T |
|
| Q |
101 |
cgataggctttattttctttaggctatcatgataatcgttcc--nnnnnnnnnnagatttgtagaaattatggccccagtcttttctcgagaagcttggc |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21652469 |
cgataggctttattttcattaggctatcatgataatagttccttttttttttttagatttgtagaaattatggccccagtcttttctcgagaagcttggc |
21652568 |
T |
|
| Q |
199 |
gttgcgtctggcatatgattcaggtatgctatgattttcaaagcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21652569 |
gttgcgtctggcatatgattcaggtatgctatgattttcaaagcac |
21652614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 153 - 225
Target Start/End: Complemental strand, 40419335 - 40419263
Alignment:
| Q |
153 |
agatttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggtat |
225 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||| ||||| |||||||| || ||||||||| ||||||||| |
|
|
| T |
40419335 |
agatttgtggaaattatggcccctgctttttctcgggaagcatggcgttgtgtgtggcatatgcttcaggtat |
40419263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 223
Target Start/End: Original strand, 37456711 - 37456778
Alignment:
| Q |
156 |
tttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggt |
223 |
Q |
| |
|
||||| || |||||||| ||||| ||||| || ||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
37456711 |
tttgttgagattatggctccagtgttttcacgtgaagcatggcgctgcgtgtggcatatgattcaggt |
37456778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 223
Target Start/End: Original strand, 39263127 - 39263194
Alignment:
| Q |
156 |
tttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggt |
223 |
Q |
| |
|
||||| || |||||||| ||||| || || |||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
39263127 |
tttgttgagattatggctccagtattctcgcgagaagcatggcgttgtgtgtggcatatgattcaggt |
39263194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University