View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14507_low_18 (Length: 298)
Name: NF14507_low_18
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14507_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 23880902 - 23880742
Alignment:
| Q |
1 |
tggtcacctgccaattacaagttttctaacagaaaattctttcacaagctctgtaacagtaacagattgatcagataaattggactgaagaattctggct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23880902 |
tggttacctgccaattacaagttttccaacaggaaattctttcacaagatctgtaacaa------attgatcagataaattggacagaagaattctggct |
23880809 |
T |
|
| Q |
101 |
tcaatcttccgcgagagcataacgaaccatccttttggtgagacagttttaacataaccctgtccaa |
167 |
Q |
| |
|
||||||||||| ||||||| || ||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23880808 |
tcaatcttccgtgagagcagaatgaagcatccttttgatgagacagttttaacataaccctgtccaa |
23880742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 30999197 - 30999116
Alignment:
| Q |
1 |
tggtcacctgccaattacaagttttctaacagaaaattctttcacaagctctgtaacagtaacagattgatcagataaattg |
82 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30999197 |
tggtcacctgccaattacaagttttccaacaggaaattctttcacaagatctgtaacagtaacagattgatcagataaattg |
30999116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University