View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14507_low_23 (Length: 266)

Name: NF14507_low_23
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14507_low_23
NF14507_low_23
[»] chr4 (1 HSPs)
chr4 (1-244)||(21652369-21652614)
[»] chr2 (1 HSPs)
chr2 (153-225)||(40419263-40419335)
[»] chr8 (1 HSPs)
chr8 (156-223)||(37456711-37456778)
[»] chr3 (1 HSPs)
chr3 (156-223)||(39263127-39263194)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 21652369 - 21652614
Alignment:
1 tgagaaaccgggctggtgtggtagtccagatttgcctccttgtgccgcgtatggtctttcttcttccttgatgcaaattttaaatgtaacttaacttttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21652369 tgagaaaccgggctggtgtggtagtccagatttgcctccttgtgccgcgtatggtctttcttcttccttgatgcaaattttaaatgtaacttaacttttt 21652468  T
101 cgataggctttattttctttaggctatcatgataatcgttcc--nnnnnnnnnnagatttgtagaaattatggccccagtcttttctcgagaagcttggc 198  Q
    ||||||||||||||||| |||||||||||||||||| |||||            ||||||||||||||||||||||||||||||||||||||||||||||    
21652469 cgataggctttattttcattaggctatcatgataatagttccttttttttttttagatttgtagaaattatggccccagtcttttctcgagaagcttggc 21652568  T
199 gttgcgtctggcatatgattcaggtatgctatgattttcaaagcac 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
21652569 gttgcgtctggcatatgattcaggtatgctatgattttcaaagcac 21652614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 153 - 225
Target Start/End: Complemental strand, 40419335 - 40419263
Alignment:
153 agatttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggtat 225  Q
    |||||||| |||||||||||||| |  |||||||| ||||| |||||||| || ||||||||| |||||||||    
40419335 agatttgtggaaattatggcccctgctttttctcgggaagcatggcgttgtgtgtggcatatgcttcaggtat 40419263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 223
Target Start/End: Original strand, 37456711 - 37456778
Alignment:
156 tttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggt 223  Q
    ||||| || |||||||| ||||| ||||| || ||||| ||||| ||||| |||||||||||||||||    
37456711 tttgttgagattatggctccagtgttttcacgtgaagcatggcgctgcgtgtggcatatgattcaggt 37456778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 223
Target Start/End: Original strand, 39263127 - 39263194
Alignment:
156 tttgtagaaattatggccccagtcttttctcgagaagcttggcgttgcgtctggcatatgattcaggt 223  Q
    ||||| || |||||||| ||||| || || |||||||| |||||||| || |||||||||||||||||    
39263127 tttgttgagattatggctccagtattctcgcgagaagcatggcgttgtgtgtggcatatgattcaggt 39263194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University