View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14507_low_30 (Length: 216)
Name: NF14507_low_30
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14507_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 3427049 - 3426871
Alignment:
| Q |
28 |
cttactaatctgtaatatagtgtaataggaagaaggtattaatgttgaatgtacgcgatataagttttggtgtctactacagaaaattaggctgtcaatt |
127 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427049 |
cttactaatttgtaatatagtgtaataggaagaaggtattaatgttgaatgtacgcgatataaattttggtgtctactacagaaaattaggctgtcaatt |
3426950 |
T |
 |
| Q |
128 |
tctagagtttaaataaactca-tttgtctacgtg--atcaacttgtaaactcgacttatggattctcacaagtttattt |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426949 |
tctagagtttaaataaactcattttgtctacgtgaaatcaacttgtaaactcgacttatggattctcacaagtttattt |
3426871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 3427825 - 3427795
Alignment:
| Q |
1 |
tgggtaaatatccgatggaagctactactta |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3427825 |
tgggtaaatatccgatggaagctactactta |
3427795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University