View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14507_low_31 (Length: 201)
Name: NF14507_low_31
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14507_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 31 - 185
Target Start/End: Original strand, 1350755 - 1350909
Alignment:
| Q |
31 |
agagaaattgtaatgagtaaccttatgaacaaaactcttctcaacaattatacaagttctagttctgtgacattgcttgtgctatctactcaattgataa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350755 |
agagaaattgtaatgagtaaccttatgaacaaaactcttctcaacaattatacaagttctagttctgtgacattgcttgtgctatctactcaattgataa |
1350854 |
T |
|
| Q |
131 |
tctcattttatgttcatagttggtcttgtgaagttggtgtattactgtttggttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350855 |
tctcattttatgttcatagttggtcttgtgaagttggtgtattactgtttggttt |
1350909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Original strand, 1361280 - 1361318
Alignment:
| Q |
43 |
atgagtaaccttatgaacaaaactcttctcaacaattat |
81 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
1361280 |
atgagtaaccttatggataaaactcttctcaacaattat |
1361318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University