View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14508_low_6 (Length: 379)
Name: NF14508_low_6
Description: NF14508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14508_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 5 - 364
Target Start/End: Original strand, 14021654 - 14022013
Alignment:
| Q |
5 |
cctccaccgccaccagaagttgatggcaaagcaagtgtcccagtcctctgctgtccagatacatgcaaataccccgctggagttcgataataagccgcga |
104 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021654 |
cctccaccgccaccagaagtagacggcaaagcaagtgtcccagtcctctgctgtccagaaacatgcaaataccccgctggagttcgataataagccgcga |
14021753 |
T |
 |
| Q |
105 |
actgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatctgccgatgactcttttcggtggaagttacggtg |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021754 |
attgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatctgccgatgactcttttcggtggaagttacggtg |
14021853 |
T |
 |
| Q |
205 |
gcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgcaaccatcaagagcatgaccaccaatacctaca |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14021854 |
gcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgcaaccatcaagagcatgacccccaatacctaca |
14021953 |
T |
 |
| Q |
305 |
gcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021954 |
gcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
14022013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 188 - 227
Target Start/End: Original strand, 2494675 - 2494714
Alignment:
| Q |
188 |
cggtggaagttacggtggcagttacaagcagcacatttta |
227 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2494675 |
cggtggaagttacggtggcagccacaagcagcacatttta |
2494714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University