View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14509_high_6 (Length: 233)
Name: NF14509_high_6
Description: NF14509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14509_high_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 233
Target Start/End: Original strand, 39743552 - 39743768
Alignment:
| Q |
17 |
gtatgtgcatgcagttcaggaacatcagctggagagcctaaattgatgccatcaattgctgaagatcttgatcgacgtacctttgtgtacaatcttatca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39743552 |
gtatgtgcatgcagttcaggaacatcagctggagagcctaaattgatgccatcaattgctgaagatcttgatcgacgtacctttgtgtacaatcttatca |
39743651 |
T |
|
| Q |
117 |
cgccaatcatgaatcagttaatatacttacaactacacaacttttttatttaagggaactttcttattcttatttgccatgattatgtgcatggtagaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39743652 |
tgccaatcatgaatcagttaatatacttacaactacacaacttttttatttaagggaactttcttattcttatttgccatgattatgtgcatggtagaca |
39743751 |
T |
|
| Q |
217 |
gaactattagtcacccc |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39743752 |
gaactattagtcacccc |
39743768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University