View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14509_low_6 (Length: 298)
Name: NF14509_low_6
Description: NF14509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14509_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 105 - 286
Target Start/End: Complemental strand, 384959 - 384776
Alignment:
| Q |
105 |
ttttaccattacatcacattaaagggctttcagttgaacagtgatagttattatatcctaaacattggtttatgtaagacaggag---atactactcaat |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
384959 |
ttttacaattacatcacattaaagggctttcacttgaacagtgatagttattatatcctaatcattggtttatgtaagacaggaggagata-tactcaat |
384861 |
T |
 |
| Q |
202 |
tagccatacccttgttgagacggttgccacattattttgacatttacactctcactgacttgcataactcagtcatacacaggtt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384860 |
tagccatacccttgttgagacggttgccacattattttgacatttacactctcactgacttgcataactcagtcatacacaggtt |
384776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University