View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_high_13 (Length: 322)
Name: NF1450_high_13
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_high_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 4 - 322
Target Start/End: Original strand, 7922542 - 7922860
Alignment:
| Q |
4 |
gggtctgagatatttcccacccaagttcaggatcatacatttctagcaacatttcaacagtccaaggttcctctgatttaggggttgaactgaacttgat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7922542 |
gggtctgagatatttcccacccaagttcaggatcctacatttctagcaacctttcaacagtccaaggttcctctgatttaggggttaaactgaacttgat |
7922641 |
T |
|
| Q |
104 |
tcaaaatgatttgttctgttctccaaaatgaatgatgatcaaattgaatatctagtacttggataaaatgcattgtttaagatgtaaatttggatacaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7922642 |
tcaaaatgatttgttctgttctccaaaatgaatgatgatcaaattgaatatctagtacttggataaaatgcattgtttaagatgtaaatttggatacaat |
7922741 |
T |
|
| Q |
204 |
atggaacatcgcctttcacagaacggttgataaatagtcgttttattgctttataggggaaaatttcactactaagcataacataaatatactgatagat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7922742 |
atggaacatcgcctttcacagaacggttgataaatagtcgttttattgctttataggggaaaatttcagtactaagcataacataaatatactgatagat |
7922841 |
T |
|
| Q |
304 |
aatactggtgaatgtctac |
322 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7922842 |
aatactggtgaatgtctac |
7922860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University