View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_high_15 (Length: 300)
Name: NF1450_high_15
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 41693928 - 41693661
Alignment:
| Q |
16 |
atggataagtcctaacaaaacttgattccttcactccacatatcctcaaagatggttttgcacgcagcaactctactcaaacttcatctacaattagcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41693928 |
atggataagtcctaacaaaacttgattccttcactccacatatcctcaaagatggttttgcacgcagcaactctactcaaacttcatctgcaattagcaa |
41693829 |
T |
|
| Q |
116 |
aacctgcagtagctggtttttcaactaccatatgtgtgctcaagctgttgatgggttttagattcttcaaagatgaagcactttaccaatcaaaattgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693828 |
aacctgcagtagctggtttttcaactaccatatgtgtgctcaagctgttgatgggttttagattcttcaaagatgaagcactttaccaatcaaaattgtt |
41693729 |
T |
|
| Q |
216 |
tcttttcagattgagtcaaatagctttcaatagtgaacctcaagtttcaactgtacaaagaatggaac |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693728 |
tcttttcagattgagtcaaatagctttcaataatgaacctcaagtttcaactgtacaaagaatggaac |
41693661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University