View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_high_27 (Length: 237)
Name: NF1450_high_27
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8570031 - 8569810
Alignment:
| Q |
1 |
ttgaccttggaagagcactctatgttttgactgtctcttttctgattaaccgctctcaaagtacta-gaatatttggctatggaaatgcagaactttaat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8570031 |
ttgaccttggaagagcactctatgttttgactgtctcttttctgattaactgctctcaaagtactaagaatatttggctatggaaatgcagaactttaat |
8569932 |
T |
 |
| Q |
100 |
ttcagtttgattgcttttgttaacaaatgtcagcaacacactcctttggtgggttcatgtgaatttttaaccaatcaaaaatactatttacattttattt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8569931 |
ttcagtttgattgcttttgttaacaaatgctagcaacacactcttttcgtgggttcatgtgaatttttaaccaatcaaaaatactatttatattttattt |
8569832 |
T |
 |
| Q |
200 |
tcattatagtaatgtgacatat |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8569831 |
tcattatagtaatgtgacatat |
8569810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University