View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_high_30 (Length: 224)
Name: NF1450_high_30
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_high_30 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 26447 - 26240
Alignment:
| Q |
18 |
caacagaatcatctctcattgggaggaatctagctatggtcttaaccaaatctgcaaactcatggacccctaaaacaaacagatatatcatgaaaact-g |
116 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26447 |
caactgaataatctctcattgggaggaatctagctatggtcttaaccaaatctgcaaactcatggacccctaaaacaaacagatatatcatgaaaacttg |
26348 |
T |
 |
| Q |
117 |
taataaaaagaaatcaacaacaaaaccaccatgaaccactctatcgccgtcgctgcatgcattgacatctccacgtgcatttcatttgtccctcattcaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26347 |
taataaaaagaaatcaacaacaaaaccaccatgaaccactctatcgccgtcgctgcatgcattgacatctccacgtgcatttcatttgtccctcattgaa |
26248 |
T |
 |
| Q |
217 |
gtttttta |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
26247 |
gtttttta |
26240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University