View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_low_15 (Length: 312)
Name: NF1450_low_15
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 47285924 - 47286235
Alignment:
| Q |
1 |
attatactaaaccgtttatctgatttggtttctgatgaactgaaaattaccggtgttaaaacaggttgacatccgttttcccatccagctgtacctgatc |
100 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47285924 |
attacactaaatcgtttatctgatttggtttctgatgaacggaaaattaccggtgttaaaacaggttgacgtccgttttcccatccagctgtacctgatc |
47286023 |
T |
 |
| Q |
101 |
cagcgccgttaattataataacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcatattctcaataatccaactaggattcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286024 |
cagcgccgttaattataataacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcatattctcaataatccaactaggattcga |
47286123 |
T |
 |
| Q |
201 |
atccgttactttgagaaatccacatgttttaagtgctggcatgaagttctttccctttgcagcttcgaatgatcctcgaggtgctcccccacagatcatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286124 |
atccgttactttgagaaatccacatgttttaagtgctggcatgaagttctttccctttgcagcttcgaatgatcctcgaggtgctcccccacagatcatg |
47286223 |
T |
 |
| Q |
301 |
attgtagcttcc |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47286224 |
attgtagcttcc |
47286235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University