View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_low_19 (Length: 286)
Name: NF1450_low_19
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 24 - 139
Target Start/End: Complemental strand, 32742007 - 32741892
Alignment:
| Q |
24 |
tccaaacgaaactcaccgttcacccatagcttccgccatcgaaaacggcatcatttgggactccgtttactttattcgtgccgctgaatgtggctacgaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742007 |
tccaaacgaaactcaccgttcacccatagcttcctccatcgaaaacggcatcatttgggactccgtttactttattcgtgccgctgaatgtggctacgaa |
32741908 |
T |
|
| Q |
124 |
tatgaacaatcctacg |
139 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32741907 |
tatgaacaatcctacg |
32741892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 217 - 268
Target Start/End: Complemental strand, 32741814 - 32741763
Alignment:
| Q |
217 |
atcaataatctcgcttttgttctagctgctctttacttttacaggtactact |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32741814 |
atcaataatctcgcttttgttctagctgctctttacttttacaggtactact |
32741763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University