View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1450_low_21 (Length: 278)
Name: NF1450_low_21
Description: NF1450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1450_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 5758265 - 5758510
Alignment:
| Q |
15 |
caaaggccaaaagataattcttctacaatataatcaacctaaggcatcatatgaaatactcacatgttagtaaaacatgacaaagattgtagaacaacat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758265 |
caaaggccaaaagataattcttctacaatataatcaacctaaggcatcatatgaaatactcacatgttagtaaaacatgacaaagattgtagaacaacat |
5758364 |
T |
 |
| Q |
115 |
atatcaatgccatacattcaaacagttgtcaatagtagaagagtacttactttcaatgagtcgaaaccaaactttcaacgtgagagaacggacatgcttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758365 |
atatcaatgccatacattcaaacagttgtcaatagtagaagagtacttactttcaatgagtcgaaaccaaactttcaacgtgagagaacggacatgcttt |
5758464 |
T |
 |
| Q |
215 |
accggaatattttctcactaatctactttcttcccgagtatacctc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758465 |
accggaatattttctcactaatctactttcttcccgagtatacctc |
5758510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 195
Target Start/End: Complemental strand, 10482489 - 10482457
Alignment:
| Q |
163 |
actttcaatgagtcgaaaccaaactttcaacgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10482489 |
actttcaatgagtcgaaaccaaactttcaacgt |
10482457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 195
Target Start/End: Complemental strand, 10468350 - 10468318
Alignment:
| Q |
163 |
actttcaatgagtcgaaaccaaactttcaacgt |
195 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
10468350 |
actttcaatgagtcaaaaccaaactttcaacgt |
10468318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 5979391 - 5979324
Alignment:
| Q |
125 |
catacattcaaacagttgtcaatagtagaagagtacttactttcaatgagtcgaaaccaaactttcaa |
192 |
Q |
| |
|
|||| ||||||||| ||| ||| |||||||| |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
5979391 |
catagattcaaacaattgaaaatgatagaagagaacttacttccaatgagtcgaaaccaagctttcaa |
5979324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University