View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14510_high_2 (Length: 245)
Name: NF14510_high_2
Description: NF14510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14510_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 42519474 - 42519283
Alignment:
| Q |
9 |
tagattatactcatctcttggtcgagcttcagattaccaggaccctcgttccatataatcggggtttaagaccagaaaagagatatattctattctcttt |
108 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42519474 |
tagattttactcatctcttggccaagcttcagattacctggaccctcgttccatacaatcggggtttaagaccagaaaagagatatattctattctcttt |
42519375 |
T |
|
| Q |
109 |
attagcagaaactaatgaataaagttcataaaggaatttcagatgaatcacatccaccagaaaaagtaaaactactttacaaggattatatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42519374 |
attagcagaaactaatgaataaagttcataaaggaatttcagatgaatcacatccaccagaaaaattaaaactactttacaaggattatatc |
42519283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University