View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14510_low_7 (Length: 213)
Name: NF14510_low_7
Description: NF14510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14510_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 82 - 197
Target Start/End: Complemental strand, 45666633 - 45666518
Alignment:
| Q |
82 |
tgcattctgcgtggagcatttggtaggatattaaaccgtcatatgaaaaatatgcatcaatatccaattgaaagaacacaaaatttcttacgtaatagct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666633 |
tgcattctgcgtggagcatttggtaggatattaaaccgtcatatgaaaaatatgcatcaatatccaattgaaagaacacaaaatttcttacgtaatagct |
45666534 |
T |
 |
| Q |
182 |
aggcaatcgtgttcat |
197 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45666533 |
aggcaatcgtgttcat |
45666518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University