View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14511_low_3 (Length: 271)
Name: NF14511_low_3
Description: NF14511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14511_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 56 - 263
Target Start/End: Original strand, 2207531 - 2207739
Alignment:
| Q |
56 |
tgtaagcacaccaaaaatatcatcacatcgacaaggatagttgaactcacaacctcattagtttatctaaatgtgatttgatgatgatttaaaatcccag |
155 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2207531 |
tgtaaacacaccaaaaatatcatcacatcgacaaggatagttgaactcacaacctcattagtttatctaaatgtgatttgatgatgatttaaaatcccag |
2207630 |
T |
 |
| Q |
156 |
tgccataagaaaacattgttagctcacatatcttaacaca-tttttnnnnnnnnncatataataaattcacgtcttctcaaacgttattcttatactctc |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2207631 |
tgccagaagaaaacattgttagctcacatatcttaacacatttttttaaaaaaaacatataatagattcacgtcttctcaaacgttattcttatactctc |
2207730 |
T |
 |
| Q |
255 |
tctgctcct |
263 |
Q |
| |
|
|||| |||| |
|
|
| T |
2207731 |
tctgatcct |
2207739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 2207574 - 2207511
Alignment:
| Q |
1 |
tcaactatccttgtcgatgtgacgatatttttggtgtgtttacagtaactagttgtgtaagcac |
64 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2207574 |
tcaactatccttgtcgatgtgatgatatttttggtgtgtttacagtaactagttgtgtaagcac |
2207511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University