View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14511_low_8 (Length: 227)

Name: NF14511_low_8
Description: NF14511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14511_low_8
NF14511_low_8
[»] chr6 (3 HSPs)
chr6 (13-139)||(17254044-17254170)
chr6 (91-139)||(17247140-17247188)
chr6 (54-94)||(17247197-17247237)


Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 17254170 - 17254044
Alignment:
13 aaaaatataagcgatgaagattatagaaacaagttaaagaatgctcaagtcactaaaactaggcgacaagtcacaagaagttctagtgctctcaaggata 112  Q
    |||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||    
17254170 aaaaatataagcgatgaagattatagaaacaagttaaagaattctaaagtaactaaaactaggcgacaagtcacaagaagttctagtgctctcaaggata 17254071  T
113 ataacatggttattatgagtacttcta 139  Q
    |||||||||||||||||||||||||||    
17254070 ataacatggttattatgagtacttcta 17254044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 17247188 - 17247140
Alignment:
91 agttctagtgctctcaaggataataacatggttattatgagtacttcta 139  Q
    |||||||||||||||||| || |||||||||||| ||||| ||||||||    
17247188 agttctagtgctctcaagtattataacatggttactatgactacttcta 17247140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 17247237 - 17247197
Alignment:
54 tgctcaagtcactaaaactaggcgacaagtcacaagaagtt 94  Q
    |||||||||||||||||||||  ||||||||| ||||||||    
17247237 tgctcaagtcactaaaactagaggacaagtcagaagaagtt 17247197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University