View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14511_low_8 (Length: 227)
Name: NF14511_low_8
Description: NF14511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14511_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 17254170 - 17254044
Alignment:
| Q |
13 |
aaaaatataagcgatgaagattatagaaacaagttaaagaatgctcaagtcactaaaactaggcgacaagtcacaagaagttctagtgctctcaaggata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17254170 |
aaaaatataagcgatgaagattatagaaacaagttaaagaattctaaagtaactaaaactaggcgacaagtcacaagaagttctagtgctctcaaggata |
17254071 |
T |
|
| Q |
113 |
ataacatggttattatgagtacttcta |
139 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17254070 |
ataacatggttattatgagtacttcta |
17254044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 17247188 - 17247140
Alignment:
| Q |
91 |
agttctagtgctctcaaggataataacatggttattatgagtacttcta |
139 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||| |||||||| |
|
|
| T |
17247188 |
agttctagtgctctcaagtattataacatggttactatgactacttcta |
17247140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 17247237 - 17247197
Alignment:
| Q |
54 |
tgctcaagtcactaaaactaggcgacaagtcacaagaagtt |
94 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
17247237 |
tgctcaagtcactaaaactagaggacaagtcagaagaagtt |
17247197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University