View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14512_low_11 (Length: 391)
Name: NF14512_low_11
Description: NF14512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14512_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 45 - 375
Target Start/End: Complemental strand, 6854570 - 6854239
Alignment:
| Q |
45 |
aattgccagtagctaagatgtaatgattgtaatctacatagactaacatcactatagtgtagtaaagagtgataagtgtaaacagaaaaaggttatgtct |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6854570 |
aattgccagtagctaagatgtaatgattgtaatctacatagactaacatcactatagtgtagtaaagagtgataagtgtaaacaaaaaaaggttatgtct |
6854471 |
T |
|
| Q |
145 |
gcttggtgtaaaatgtg-tttcttgatgcagaagttaggtgtttaaacaaaattctttgagctagattgaggccatagattgctttatacaatttgcaca |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6854470 |
gcttggtgtaaaatgtggtttcttgatgcagaagttaggtgtttaaacaaaattctttgagctagattgaggccataaattgctttatacaatttgcaca |
6854371 |
T |
|
| Q |
244 |
ctagagatttatcttttaatccaaagcctaggaactaggatgttacatatattctagttcctcaggcacactactgagcattagaataaactaatcctta |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6854370 |
ctagagatttatcttttaatccaaagcctaggaactaggatgttacatatattctagttcctcaggcacactactgggcattagaataaactaatcctta |
6854271 |
T |
|
| Q |
344 |
ggaaacaatcaaagatatttcaagattagaaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6854270 |
ggaaacaatcaaagatatttcaagattagaaa |
6854239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 217 - 273
Target Start/End: Original strand, 6824196 - 6824252
Alignment:
| Q |
217 |
catagattgctttatacaatttgcacactagagatttatcttttaatccaaagccta |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6824196 |
catagattgctttatacaatttgcacactagagatttatcttctaatccaaagccta |
6824252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University