View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14513_low_11 (Length: 218)
Name: NF14513_low_11
Description: NF14513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14513_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 5851313 - 5851515
Alignment:
| Q |
1 |
ataaatgaagcttcaatcacagtggtagaggcgcgttagaatgactaacatggattaaatactgtacaaatgtgctaaaatttggtttctacaaatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5851313 |
ataaatgaagcttcaatcacagtggtagaggcgcgttagaatgactaacatggattaaatactgtacaaatgtgctaaaatttggtttctacaaatataa |
5851412 |
T |
 |
| Q |
101 |
tggggaaaattctattttgctctgaacagctaactattttacccacctgaataaattgtatgatttctgaagttatggctattaggagcttatatgtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5851413 |
tggggaaaattctattttgctctgaacagctaactattttacccacctgaataaattgtatgatttctgaagttatggctattaggagcttatatgtgtg |
5851512 |
T |
 |
| Q |
201 |
ttg |
203 |
Q |
| |
|
||| |
|
|
| T |
5851513 |
ttg |
5851515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University