View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14513_low_12 (Length: 214)

Name: NF14513_low_12
Description: NF14513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14513_low_12
NF14513_low_12
[»] chr1 (1 HSPs)
chr1 (14-197)||(4609621-4609804)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 4609621 - 4609804
Alignment:
14 ataatacttttgttacttgtaccaatttctgatactacagcatcatgaactttgtcaactttattgtctagcatatttggcaatggtgaaggtggagaat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||    
4609621 ataatacttttgttacttgtaccaatttctgatactacagcatcatgaattttgtcaactttattgtctagcatatttggcagtggtgaaggtggagaat 4609720  T
114 gctgattttgtgaagcagggaaattgatttctgaattttgagggttggaactttgagttagtgatggagttgaagggatagtat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4609721 gctgattttgtgaagcagggaaattgatttctgaattttgagggttggaactttgagttagtgatggagttgaagggatagtat 4609804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University