View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14513_low_12 (Length: 214)
Name: NF14513_low_12
Description: NF14513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14513_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 4609621 - 4609804
Alignment:
| Q |
14 |
ataatacttttgttacttgtaccaatttctgatactacagcatcatgaactttgtcaactttattgtctagcatatttggcaatggtgaaggtggagaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4609621 |
ataatacttttgttacttgtaccaatttctgatactacagcatcatgaattttgtcaactttattgtctagcatatttggcagtggtgaaggtggagaat |
4609720 |
T |
 |
| Q |
114 |
gctgattttgtgaagcagggaaattgatttctgaattttgagggttggaactttgagttagtgatggagttgaagggatagtat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609721 |
gctgattttgtgaagcagggaaattgatttctgaattttgagggttggaactttgagttagtgatggagttgaagggatagtat |
4609804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University