View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14513_low_8 (Length: 278)
Name: NF14513_low_8
Description: NF14513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14513_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 11 - 175
Target Start/End: Complemental strand, 775004 - 774840
Alignment:
| Q |
11 |
tatatataatttgtgtgaactaaattgtatataacccttttgttttcttcattttttgaatccttaattaggatggtaaccaatattccagcgactactg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
775004 |
tatatataatttgtgtgaactaaattgtatataacccttttgttttcttcattttttgaatccttaattaggatggtaaccaatattccagcgactacag |
774905 |
T |
 |
| Q |
111 |
ggacaactttcggtatgtacacaattttcttagacttttaattttagtgtaaatcaattatcttt |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
774904 |
ggacaactttcggtatgtgcacaattttcttagacttttaattttagtgtaaatcaattatcttt |
774840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 53 - 125
Target Start/End: Complemental strand, 815627 - 815555
Alignment:
| Q |
53 |
ttttcttcattttttgaatccttaattaggatggtaaccaatattccagcgactactgggacaactttcggta |
125 |
Q |
| |
|
|||||||| || ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
815627 |
ttttcttccttcattggatccttaattaggatggtaaccaatattccagcgactacagggacaactttcggta |
815555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University