View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14514_high_5 (Length: 274)
Name: NF14514_high_5
Description: NF14514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14514_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 14316100 - 14315959
Alignment:
| Q |
48 |
aatgaaaatatataactgaagagttaagaatcaaattacggacacacccaccatccatccatcaactcgcgactattccttcaaccactctccacacaaa |
147 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14316100 |
aatgaaaatatataactgaagacttaagaatcaaattacggacacacccaccatccatccatcaactcgcgactattccttcaaccactctccacacaaa |
14316001 |
T |
 |
| Q |
148 |
ctcgcaaccaccgcttcacaaatgaacaacaaccaaacttgg |
189 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14316000 |
ctcacaaccaccgcctcacaaatgaacaacaaccaaacttgg |
14315959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 14316169 - 14316117
Alignment:
| Q |
1 |
gtttaataaccgtaacttgactaaaaaataaaagttttaataactgtaatgaaa |
54 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| ||||||||| |
|
|
| T |
14316169 |
gtttaataaccgtaacttgaccaagaaa-aaaagttttaataaccgtaatgaaa |
14316117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University