View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14515_high_4 (Length: 341)
Name: NF14515_high_4
Description: NF14515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14515_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 17 - 335
Target Start/End: Complemental strand, 53806155 - 53805838
Alignment:
| Q |
17 |
ataatgctcattcattaccattgataaaattgaccaataaacaacacttcataccacagcccatcccaatgaaattcctccttttcaataagatacaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53806155 |
ataatgctcattcattaccattgataaaattgaccaataaacaacacttcataccacagcccatcccaatgaaattcctccttttcaataag-tacaaac |
53806057 |
T |
 |
| Q |
117 |
aaattcataattttaaacccgttatcttttttcccattttcccatccaaacataacgatgggctgcaacgcctcaagacttgaccggcttccggccgtgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53806056 |
aaattcataattttaaacccgttatcttttttcccattttcacatccaaacataacgatgggctgcaacgcctcaagacttgaccggcttccggccgtgt |
53805957 |
T |
 |
| Q |
217 |
cattgtgccgcgaccgttgcaaattcatcgacgaatcactccgtcaaagctactccctcgccgatgcacacgtggcacacatgtattccctcagaacact |
316 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805956 |
cattgtgccgcgaccgtttcaaattcatcgacgaatcactccgtcaaagctactccctcgccgatgcacacgtggcacacatgtattccctcagaacact |
53805857 |
T |
 |
| Q |
317 |
tggccctactctccttcat |
335 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53805856 |
tggccctactctccttcat |
53805838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University