View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14515_low_12 (Length: 256)
Name: NF14515_low_12
Description: NF14515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14515_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 526117 - 525895
Alignment:
| Q |
15 |
agcagagagacgttgcgattggaacatatatgtaagtgggtcatgtagtataagaaactaaaaaacaagtgggtgggggtgtgggaagggaattatggaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
526117 |
agcagagagacgttgcgattggaacatatatgtaagtgggtcatgtagtataagaaactaaaaaacaagtgggtgggggtgtgggaagggaattatggaa |
526018 |
T |
 |
| Q |
115 |
ctgctatggtttaagaggttgtcctaaaagagaatgaaaaaacacatgcaaaatgagtttgaatatgatagaagattattacttaggaggtggtgatggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
526017 |
ctgctatggtttaagaggttgtcctaaaagagaatgaaaaaacacatgaaaaatgagtttgaatatgatataagattattagttaggaggtggtgatggt |
525918 |
T |
 |
| Q |
215 |
gaagcctgagaagaggtgaaaag |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
525917 |
gaagcctgagaagaggtgaaaag |
525895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University