View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14515_low_6 (Length: 327)
Name: NF14515_low_6
Description: NF14515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14515_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 219 - 324
Target Start/End: Complemental strand, 17724777 - 17724672
Alignment:
| Q |
219 |
tctagatatttccgcaaccatcaacacgttgcatttgccttaatcaacgaacgcatcttccgccgaaataaccgatcctttttatatacaacagtttcac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724777 |
tctagatatttccgcaaccatcaacacgttgcatttgccttaatcaacgaacgcatcttctgccgaaataaccgatcctttttatatacaacagtttcac |
17724678 |
T |
|
| Q |
319 |
aggttc |
324 |
Q |
| |
|
||||| |
|
|
| T |
17724677 |
cggttc |
17724672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 17724996 - 17724880
Alignment:
| Q |
1 |
caacataaatcaattcaacagttctttcatgtcgaccaaaattatgcaatgatccaaacagaaaaattgattatcaagcatcatgagaatgttgcactac |
100 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17724996 |
caacatatatcaattcaacagttcttccatgtcgaccaaaattatgcaatgatccaaacacaaaaattgacaatcaagcatcatgagaatgttgcactac |
17724897 |
T |
|
| Q |
101 |
attccaaaattttacat |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17724896 |
attccaaaattttacat |
17724880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University