View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14518_high_8 (Length: 246)
Name: NF14518_high_8
Description: NF14518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14518_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 32897325 - 32897098
Alignment:
| Q |
1 |
acaacgagaagagtgccacggaatctgtagatcttatcggagagtgactcctgacgcgttggacgtttgagcattttggtgaattcggagtcggaggagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32897325 |
acaacgagaagagtgccacggaatctgtagatcttatcggagagtgactcctgacgcgttggacgtttgagcattttggtgaattcggagtcggaggagt |
32897226 |
T |
 |
| Q |
101 |
ggttatcggaaggcggagaagtggattgaacggcggagagttcggtggaggaaagtgatcggtaacggatctgaccgtgaccgttggatgtggtggcagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32897225 |
ggttatcggaaggcggagaagtggattgaacggcggagagttcggtggaggaaagtgatcggtaacggatctgaccgtgaccgttggatgtggtggcagg |
32897126 |
T |
 |
| Q |
201 |
tggagcctgatattgtttgggatcttgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32897125 |
tggagcctgatattgtttgggatcttgt |
32897098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University