View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14520_high_14 (Length: 289)
Name: NF14520_high_14
Description: NF14520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14520_high_14 |
 |  |
|
| [»] scaffold1183 (2 HSPs) |
 |  |  |
|
| [»] scaffold1384 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1183 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: scaffold1183
Description:
Target: scaffold1183; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 124 - 286
Target Start/End: Complemental strand, 806 - 644
Alignment:
| Q |
124 |
tgatattgtggatgatgtcaaacggttgagggaaacattgaaacaaatctctagtgctttgaattggagtcacatgtgaatgacctctatttgttgctag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
806 |
tgatattgtggatgatgtcaaacggttgagggaaacattgaaacaaatctctagtgctttgaattggagtcacatgtgaatgacctctatttgttgctag |
707 |
T |
 |
| Q |
224 |
attaacagcttgtttgacgagtatcgcatcctcttgtgtcagagcctgcaactctctgctgct |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
706 |
attaacagcttgtttaacgagtatcgcatcctcttgtgtcagagcctgcaactgtgtgctgct |
644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1183; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 890 - 803
Alignment:
| Q |
1 |
ttgttggttctcaaaagaataattagcacagcgttggtgatcctgagcacatttgaaggctgcaactaaggaattggaaattagtgat |
88 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
890 |
ttgttggttctcaatagaataattagcacagcgttggtgatcctgagcacatttgaaggctgcaactaaggaattggaaattagtgat |
803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1384 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: scaffold1384
Description:
Target: scaffold1384; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 31 - 191
Target Start/End: Original strand, 822 - 979
Alignment:
| Q |
31 |
gcgttggtgatcctgagcacatttgaaggctgcaactaaggaattggaaattagtgatggagatgaatatcaaggaccgcccagaacaagacttgatatt |
130 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||| ||||||||||||||| |||| || || |||||| |||||||| | || | |||||||||| |
|
|
| T |
822 |
gcgttggtgaccctgagcacttttaaaggctgcacctaaggaattggaaa---gtgaaggtgacaaatatcgaggaccgcggaaaagagtacttgatatt |
918 |
T |
 |
| Q |
131 |
gtggatgatgtcaaacggttgagggaaacattgaaacaaatctctagtgctttgaattgga |
191 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
919 |
gtggaagatggcaaacggttgagggaaacattgaaacaaatctctaatgctttgaattgga |
979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1384; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 1033 - 1084
Alignment:
| Q |
225 |
ttaacagcttgtttgacgagtatcgcatcctcttgtgtcagagcctgcaact |
276 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
1033 |
ttaacagcttgtttaacgagtattgcagcctcttgtgtcagagcctgaaact |
1084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University