View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14520_high_19 (Length: 236)
Name: NF14520_high_19
Description: NF14520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14520_high_19 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 143962 - 143743
Alignment:
| Q |
1 |
tttagatttagcatttgctagcctacgcttccgactgcgtcacaactaaagctcataccgagttgcttgaggctattggctcaattcgtaaccgtatgtt |
100 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
143962 |
tttagatttagaatttgctagcctacacttccgactgcgtcacaactaaagctcataccgagttgcttgaggctatgggctcaattcgtaaccgtatgtt |
143863 |
T |
 |
| Q |
101 |
gtgatgtttgagtttttcctatatatgttctacccaacaatcaacttcatgctttaagttttttaatccaattctctctataatatttaggacattgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143862 |
gtgatgtttgagtttttcctatatatgttctacccaacaatcaacttcatgctttaagttttttaatccaattctctctataatatttaggacattgtgt |
143763 |
T |
 |
| Q |
201 |
gtctaatcgaaacaatatct |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
143762 |
gtctaatcgaaacaatatct |
143743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 109
Target Start/End: Original strand, 156566 - 156632
Alignment:
| Q |
43 |
caactaaagctcataccgagttgcttgaggctattggctcaattcgtaaccgtatgttgtgatgttt |
109 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| | ||| |||||| ||| |||| |||||||||||| |
|
|
| T |
156566 |
caactaaagctcatactgagttgattgaggcaaaaggcacaattcctaaacgtacgttgtgatgttt |
156632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 19404150 - 19404109
Alignment:
| Q |
1 |
tttagatttagcatttgctagcctacgcttccgactgcgtca |
42 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19404150 |
tttaggtttagcatttgctagcctacgcttccgattgcgtca |
19404109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 4133310 - 4133281
Alignment:
| Q |
7 |
tttagcatttgctagcctacgcttccgact |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4133310 |
tttagcatttgctagcctacgcttccgact |
4133281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 42
Target Start/End: Complemental strand, 13991419 - 13991380
Alignment:
| Q |
3 |
tagatttagcatttgctagcctacgcttccgactgcgtca |
42 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13991419 |
tagatttagcgcttgctagcctacgcttccgactgcgtca |
13991380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 10928342 - 10928379
Alignment:
| Q |
7 |
tttagcatttgctagcctacgcttccgactgcgtcaca |
44 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
10928342 |
tttagcacttgctagcctacgcttcctactgcgtcaca |
10928379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 28659601 - 28659569
Alignment:
| Q |
7 |
tttagcatttgctagcctacgcttccgactgcg |
39 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
28659601 |
tttagcatttgctagcctacgcttctgactgcg |
28659569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 28661110 - 28661074
Alignment:
| Q |
1 |
tttagatttagcatttgctagcctacgcttccgactg |
37 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
28661110 |
tttaggtttagcacttgctagcctacgcttccgactg |
28661074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 118
Target Start/End: Complemental strand, 6912982 - 6912910
Alignment:
| Q |
46 |
ctaaagctcataccgagttgcttgaggctattggctcaattcgtaaccgtatgttgtgatgtttgagtttttc |
118 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||| |||||| ||| |||||||| ||||||||||| |||| |
|
|
| T |
6912982 |
ctaaagctcatagtgagttgcttgaggcaaaaggcacaattcctaaacgtatgttccgatgtttgagtatttc |
6912910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University