View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14520_low_28 (Length: 217)
Name: NF14520_low_28
Description: NF14520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14520_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 44554191 - 44554401
Alignment:
| Q |
1 |
gcaattcaatcacatctctgctcacttccggatgttttattgttgttgcagattccaattcttttgtaattctgttcagcggtgtcaacaggtcttctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44554191 |
gcaattcaatcacatctctgctcacttccggatgttttattgttgttgcagattccaattcttttgtaattctgttcagcggtgtcaacatgtcttctac |
44554290 |
T |
|
| Q |
101 |
tcctgccatgtcattctccgccgccgcatctttaacggcctccgcttctggttcggc-aaaatcagactttcatctggcccttgccgtcaccaacataaa |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44554291 |
tcctgccatgtcattctcggccgccgcatctttaacggcctccgcttctggttcggcaaaaatcagactgtcatctggcccttgccgtcaccaacataaa |
44554390 |
T |
|
| Q |
200 |
aaacagcattc |
210 |
Q |
| |
|
||||| ||||| |
|
|
| T |
44554391 |
aaacatcattc |
44554401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 9936256 - 9936205
Alignment:
| Q |
159 |
aaatcagactttcatctggcccttgccgtcaccaacataaaaaacagcattc |
210 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9936256 |
aaatccgactttcatccggcccttgccgtcaccaacatcaaaaacagcattc |
9936205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 48103538 - 48103487
Alignment:
| Q |
159 |
aaatcagactttcatctggcccttgccgtcaccaacataaaaaacagcattc |
210 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
48103538 |
aaatccgactttcatccgacccttgccgtcaccaacatcaaaaacagcattc |
48103487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University