View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14520_low_29 (Length: 206)
Name: NF14520_low_29
Description: NF14520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14520_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 26258289 - 26258459
Alignment:
| Q |
19 |
atcaatctcaaaagtaacattatttatttgcatatcctggccccatctatgagcatagagtaagcctaaagcttctccttcatcgaatcttaggaccagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26258289 |
atcaatctcaaaagtaacattatttatttgcatatcctggccccatctatgagcatagagtaagtctaaagcttctccttcatcgaatcttaggactagt |
26258388 |
T |
 |
| Q |
119 |
gatattcacttggttcttgcgaagacaaaattttcttgaccatccccctattcgctctcaggtcacttcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258389 |
gatattcacttggttcttgcgaagacaaaattttcttgaccatccccctattcgctctcaggtcacttcat |
26258459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University