View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14521_low_10 (Length: 227)
Name: NF14521_low_10
Description: NF14521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14521_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 42007779 - 42007999
Alignment:
| Q |
7 |
gtaattttccacttctaaatggaggaagtcctaaatgacttgaaggagttgtttgaatcactataccactctttagtactttgcatatcacctaagaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42007779 |
gtaattttccacttctaaatggaggaagtcctaaatgacttgaaggagttgtttgagttactatatcactctttagtactttgcatatcacctaagaaat |
42007878 |
T |
 |
| Q |
107 |
cttaggatgagttgagagaatcaacaagggcttaaatttatgggactggtttgtaggaacataataccaaatttatcaccatgtattttagaataaacaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42007879 |
cttaggatgagttgagagaatcaacaagggcttaaatttatgggactggtttgtaggaacataataccaaatttctcaccatgtattttagaataaacaa |
42007978 |
T |
 |
| Q |
207 |
taccaagaagatggagaaaca |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42007979 |
taccaagaagatggagaaaca |
42007999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University