View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14521_low_6 (Length: 299)
Name: NF14521_low_6
Description: NF14521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14521_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 283
Target Start/End: Complemental strand, 47117128 - 47116864
Alignment:
| Q |
15 |
gacatcatcaccggcgaagatggtgatgttggcgttcccgttgagctttgttgcctatcatacattctccgcctatccatctacaaaacaagaaattaaa |
114 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117128 |
gacatcatcaccggtgaagacggtgatgttggcgttcccgttgagctttgttgcctatcatacattctccgcctatccatctacaaaacaagaaattaaa |
47117029 |
T |
|
| Q |
115 |
aataatcgttaaaaggtgatcgatcgagtcattgatacgttgatattgcttaccttgctttgtgatttgatcgttaaaaggtatgaatatttatctcctt |
214 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117028 |
aataatcgttaaaaggtgatcga----gtcattgatacgttgatattgcttaccttgctttgtgatttgatcgttaaaaggtatgaatatttatctcctt |
47116933 |
T |
|
| Q |
215 |
gaattgaaactaaagatataaaagaaattggttattgaatatctttgataaaatataactattgtaatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116932 |
gaattgaaactaaagatataaaagaaattggttattgaatatctttgataaaatataactattgtaatt |
47116864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University