View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14522_low_5 (Length: 309)

Name: NF14522_low_5
Description: NF14522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14522_low_5
NF14522_low_5
[»] chr4 (1 HSPs)
chr4 (208-292)||(33255618-33255702)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 208 - 292
Target Start/End: Original strand, 33255618 - 33255702
Alignment:
208 taaaataaaagtttggaggcacaaagagaattttatgtacagagaattcacaattttcgtttacgaggaatcaataggttttcat 292  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33255618 taaaataaaagtttggaggcacaaagagaattttatgtacagagaattcacaattttcgtttacgaggaatcaataggttttcat 33255702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University