View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14522_low_6 (Length: 233)
Name: NF14522_low_6
Description: NF14522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14522_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 117 - 217
Target Start/End: Original strand, 11642190 - 11642290
Alignment:
| Q |
117 |
tataaattacatggtttcttattggaaacatttttaataaacgatagtttcttttaagctaaaatgaatatttggtcccttaacttatttagtgtgttca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11642190 |
tataaattacatggtttcttattggaaacatttttaataaacgattgtttcttttgagctaaattgaatatttggtcccttaacttatttaacgtgttca |
11642289 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
11642290 |
t |
11642290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 89
Target Start/End: Original strand, 11642023 - 11642093
Alignment:
| Q |
19 |
ctacttgcctaattcggctaacaaaacaattatatttaggtgtaaacagttattaacatgatatgttgttt |
89 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
11642023 |
ctacttgcctaattcagctaacaaaacaattatatttaggtgcaaacagctattaacatgatatgttgttt |
11642093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University