View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14522_low_7 (Length: 231)
Name: NF14522_low_7
Description: NF14522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14522_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 14293296 - 14293526
Alignment:
| Q |
1 |
taaagagattaattaatatacaaaaaagatgataccaatgtttatactcattcagtcacatatccttccttgtgactactagagtctttaatcacgaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14293296 |
taaagagattaattaatatacaaaaaagatgataccaatgtttatactcattcagtcacatatccttccttgtgactactagagtctttaatcacgaagt |
14293395 |
T |
|
| Q |
101 |
agaaattatagtatcctttggagaagcaattacaactatagaaccctaatttcaacaactcaaactgctatcagttaacattctaaggataacctcgcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14293396 |
agaaattatagtatcctttggagaagcaattacaaccatagaaccctaatttcaacaactcaaactgctatcagttaacattctaaggataacctcgcct |
14293495 |
T |
|
| Q |
201 |
taaactacgttttgagttttatttaaatttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14293496 |
taaactacgttttgagttttatttaaatttt |
14293526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University