View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14522_low_8 (Length: 209)
Name: NF14522_low_8
Description: NF14522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14522_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 44853981 - 44854173
Alignment:
| Q |
1 |
agcacctctcatgtccatagggaagaccatgtggcagaaaaaatatggtgagagtgagaccaatttttcctctcattctctttcaactcactacaaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853981 |
agcacctctcatgtccatagggaagaccatgtggcagaaaaaatatggtgagagtgagaccaatttttcctctcattctctttcaactcactacaaagtc |
44854080 |
T |
|
| Q |
101 |
acaatcatatacacccataacaaatatggtgtatgtgttttatagctcacgaaactatctgtcaatttcacccataaccaaatttggagaagg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
44854081 |
acaatcatatacacccataacaaatatggtgtatgtgttttatagctcacgaaactatctgccaatttcacccataaccaaatttgcagaagg |
44854173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University