View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14523_high_2 (Length: 412)
Name: NF14523_high_2
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14523_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 125 - 365
Target Start/End: Original strand, 52824696 - 52824937
Alignment:
| Q |
125 |
agatgtatacactacaggg-tgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttc |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824696 |
agatgtatacactacaggggtgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttc |
52824795 |
T |
 |
| Q |
224 |
ttcataaatcagtgtaaaatattaaatatttctttcacattttgtaaataagatctttaattgaattaaataactcaacttgattgattaatttttgttt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824796 |
ttcataaatcagtgtaaaatattaaatatgtctttcacattttgtaaataagatctttaattgaattaaataactcaacttgattgattaatttttgttt |
52824895 |
T |
 |
| Q |
324 |
gcaacttgttaaaaggggtagtacgtcttgttaaatgggatt |
365 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
52824896 |
gcaacttgttaaaaggggtagtacatcttgttaaatgagatt |
52824937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 52824581 - 52824640
Alignment:
| Q |
19 |
cattcaacatctgattttctctctagcactcttcttttcacatcatcaaactatcatatc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52824581 |
cattcaacatctgattttctctctagcactcttcttttcacatcatcaaactgtcatatc |
52824640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 365 - 412
Target Start/End: Original strand, 52824960 - 52825007
Alignment:
| Q |
365 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatatca |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824960 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatatca |
52825007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University