View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14523_high_7 (Length: 244)
Name: NF14523_high_7
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14523_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 30187998 - 30187886
Alignment:
| Q |
127 |
aacagaactgttgcattgtaaaccaaataatagaagcaatacatgttagtatatcaatcaaaatgcgagtgatagcttgatattacaccagtgacaaccc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30187998 |
aacagaactgttgcattgtaaaccaaataatagaagcaatacatgttagtatatcaatcaaaatgcgagtgatagcttgatattacaccagtgacaaccc |
30187899 |
T |
 |
| Q |
227 |
aatggagaattat |
239 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30187898 |
aatggagaattat |
30187886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 30188107 - 30188061
Alignment:
| Q |
18 |
tgttttactttagatagataccatgtgtcattgtcaaagatacatgg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30188107 |
tgttttactttagatagataccatgtgtcattgtcaaagatacatgg |
30188061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University