View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14523_high_7 (Length: 244)

Name: NF14523_high_7
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14523_high_7
NF14523_high_7
[»] chr2 (2 HSPs)
chr2 (127-239)||(30187886-30187998)
chr2 (18-64)||(30188061-30188107)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 30187998 - 30187886
Alignment:
127 aacagaactgttgcattgtaaaccaaataatagaagcaatacatgttagtatatcaatcaaaatgcgagtgatagcttgatattacaccagtgacaaccc 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30187998 aacagaactgttgcattgtaaaccaaataatagaagcaatacatgttagtatatcaatcaaaatgcgagtgatagcttgatattacaccagtgacaaccc 30187899  T
227 aatggagaattat 239  Q
    |||||||||||||    
30187898 aatggagaattat 30187886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 30188107 - 30188061
Alignment:
18 tgttttactttagatagataccatgtgtcattgtcaaagatacatgg 64  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
30188107 tgttttactttagatagataccatgtgtcattgtcaaagatacatgg 30188061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University