View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14523_low_10 (Length: 238)
Name: NF14523_low_10
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14523_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 22559529 - 22559754
Alignment:
| Q |
1 |
tcgttgaggaatgatagtgccaataaagaaaacgcaaaatggagtaaacctgaaggagtggattcgtctcagaagaagaaaaggaagaagaaattaggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
22559529 |
tcgttgaggaatgatagtgccaataaagaaaacgcaaaatggagtaaacctgaaggattggattcttctcaaaagaagaaaaggaagaagaaattaggtg |
22559628 |
T |
|
| Q |
101 |
gttttaatttgcgtaaaagcttggcatgggatcgagcttttttcaccgaacaaggtattttctaattcca-tttttcttggatgagttgtgaaaatgaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22559629 |
gttttaatttgcgtaaaagcttggcatgggatcgagcttttttcaccgaacaaggtattttctatttccattttttcttggatgagttgtgaaaatgaaa |
22559728 |
T |
|
| Q |
200 |
gtgaaagtttgagcaattttattttt |
225 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
22559729 |
gtcaaagtttgagcaattttattttt |
22559754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University