View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14523_low_13 (Length: 208)
Name: NF14523_low_13
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14523_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 120
Target Start/End: Complemental strand, 47916613 - 47916511
Alignment:
| Q |
15 |
ttctctcttattcatcgtttttggtgctgcttattaaatgattcatcattgtaattgtaattgtaatgaacgtggataattagttatttttaatgaatag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47916613 |
ttctctcttattcatcgtttttggtgctgcttat---atgattcatcattgtaattgtaattgtaatgaacttggataattagttatttttaatgaatag |
47916517 |
T |
|
| Q |
115 |
gttgaa |
120 |
Q |
| |
|
|||||| |
|
|
| T |
47916516 |
gttgaa |
47916511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University