View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14523_low_5 (Length: 359)
Name: NF14523_low_5
Description: NF14523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14523_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 58 - 182
Target Start/End: Complemental strand, 44799806 - 44799682
Alignment:
| Q |
58 |
cttaaatttctatgaagaactttatgaaggcttccatatggtaaatactcataaaccaaaaccagttcattcccttcacaacactgtcctttaagctgaa |
157 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
44799806 |
cttaaattcctatgcagaactttatcaaggcttccatttggtagatactcataaaccaaaaccaattcattcccttcacaacaccaccctttaagctgaa |
44799707 |
T |
|
| Q |
158 |
ccagattcttgtgccgcaagcaacc |
182 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44799706 |
ccagattcttgtgccgcaagcaacc |
44799682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 256 - 344
Target Start/End: Original strand, 8349969 - 8350058
Alignment:
| Q |
256 |
gttgattacactcttcttgat-aagtagcagatgtaaattaatactacatgactacaagcgcgagggataatagttaacagggaaataag |
344 |
Q |
| |
|
||||||||||||||| | || |||||||||||||||||||| | | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8349969 |
gttgattacactcttgataattaagtagcagatgtaaattaacattgcatgactacaagcgtgagggataatagttaacagggaaataag |
8350058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 147 - 192
Target Start/End: Original strand, 8349624 - 8349669
Alignment:
| Q |
147 |
tttaagctgaaccagattcttgtgccgcaagcaaccaatcattgaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349624 |
tttaagctgaaccagattcttgtgccgcaagcaaccaatcattgaa |
8349669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 344
Target Start/End: Original strand, 8260574 - 8260626
Alignment:
| Q |
292 |
attaatactacatgactacaagcgcgagggataatagttaacagggaaataag |
344 |
Q |
| |
|
||||||||| ||||||||||| || ||| ||||| |||||||||||||||||| |
|
|
| T |
8260574 |
attaatactgcatgactacaaacgtgagagataagagttaacagggaaataag |
8260626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University