View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14524_high_13 (Length: 216)
Name: NF14524_high_13
Description: NF14524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14524_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 44232760 - 44232578
Alignment:
| Q |
13 |
gcaaaggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232760 |
gcaaaggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtg |
44232661 |
T |
 |
| Q |
113 |
taccaataaagcaactatcaacaagcatttttagactannnnnnnnnatttataaaatttatcttctgagctgaagtgaagaatac |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232660 |
taccaataatgcaactatcaacaagcatttttagact---tttttttatttataaaatttatcttctgagctgaagtgaagaatac |
44232578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University