View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14524_low_12 (Length: 293)
Name: NF14524_low_12
Description: NF14524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14524_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 31 - 291
Target Start/End: Complemental strand, 49126426 - 49126163
Alignment:
| Q |
31 |
tatgtctgttgtccctcaaaatatgataattttcannnnnnnnc---tcacatttgggtttctcatttatgaaaatgtttcagttttggaccttatcgct |
127 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49126426 |
tatgtccgttgtccctcaaaatatgataattttcatttttttttctttcacatttgggtttctcatttatgaaaatgtttcagttttggaccttatagct |
49126327 |
T |
 |
| Q |
128 |
aactccgtctgtcaaaaagcctatgtaacagctactgaattttgatataagaaatccttgcttggaacatctaaacgcatgtaacagacaactaagattt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49126326 |
aactccgtctgtcaaaaagcctatgtaacagctactgaattttgatataagaaatccttgcttggaacatctaaacgcatgtaacagacaactaagattt |
49126227 |
T |
 |
| Q |
228 |
tgtagcttttacacagactctctggctgatggagttggctacatggatcggagttggcaccttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
49126226 |
tgtagcttttacacagactctctgactgacgaagttggctacatggatcggagttgacaccttt |
49126163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University