View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14524_low_14 (Length: 246)
Name: NF14524_low_14
Description: NF14524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14524_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 25968805 - 25968700
Alignment:
| Q |
1 |
aaaacgacaccgtttagcacccaccttacgcatataaatacgtgtacttaactcatcgtatctcaaccattctacgtgttggttattccacactctttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25968805 |
aaaacgacaccgtttagcacccaccttacgcatataaatacgtgtccttaactcatcgtatctcaaccattctacgtgttggttattccacactctttgc |
25968706 |
T |
|
| Q |
101 |
accttg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
25968705 |
accttg |
25968700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 231
Target Start/End: Complemental strand, 25968628 - 25968575
Alignment:
| Q |
178 |
aaacaaaaacccttatagatcatcacaatgtgtggcatacttgctgtacttggt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25968628 |
aaacaaaaacccttatagatcatcacaatgtgtggtatacttgctgtacttggt |
25968575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University