View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14524_low_16 (Length: 216)

Name: NF14524_low_16
Description: NF14524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14524_low_16
NF14524_low_16
[»] chr8 (1 HSPs)
chr8 (13-198)||(44232578-44232760)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 44232760 - 44232578
Alignment:
13 gcaaaggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44232760 gcaaaggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtg 44232661  T
113 taccaataaagcaactatcaacaagcatttttagactannnnnnnnnatttataaaatttatcttctgagctgaagtgaagaatac 198  Q
    ||||||||| |||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||    
44232660 taccaataatgcaactatcaacaagcatttttagact---tttttttatttataaaatttatcttctgagctgaagtgaagaatac 44232578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University