View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14525_low_11 (Length: 235)
Name: NF14525_low_11
Description: NF14525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14525_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 128 - 196
Target Start/End: Complemental strand, 21584313 - 21584244
Alignment:
| Q |
128 |
atttgtttggggtatgtgattcacaagtttaggagaaa-ggttaagctgattatgcatctgtttagttaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21584313 |
atttgtttggggtatgtgattcacaagtttaggagaaagggttaagctgattatgcatctgtttagttaa |
21584244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 21584511 - 21584439
Alignment:
| Q |
1 |
tttctttgtaagtttaacaagattgaaatctaatgaagtaatcttttatgttgaattatgattttactttgtg |
73 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
21584511 |
tttctttgtaagtttaaaatggttgaaatctaatgaaataatcttttatggtgaattatgattctactttgtg |
21584439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 63
Target Start/End: Complemental strand, 31825414 - 31825354
Alignment:
| Q |
4 |
ctttgtaagttt-aacaagattgaaatctaatgaagtaatcttttatgttgaattatgatt |
63 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
31825414 |
ctttgtaagttttaacaagattgaaatctaatgaagtgactgtttatggtgaattatgatt |
31825354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 63
Target Start/End: Complemental strand, 24497154 - 24497094
Alignment:
| Q |
4 |
ctttgtaagttt-aacaagattgaaatctaatgaagtaatcttttatgttgaattatgatt |
63 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||| || |||||||||||| |
|
|
| T |
24497154 |
ctttgtaagtttcaacaagatttgaatctaatgaagtaattatttctggtgaattatgatt |
24497094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 32776685 - 32776641
Alignment:
| Q |
4 |
ctttgtaagttt-aacaagattgaaatctaatgaagtaatctttt |
47 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
32776685 |
ctttgtaagttttaacaagatttaaatcaaatgaagtaatctttt |
32776641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 10575614 - 10575687
Alignment:
| Q |
1 |
tttctttgtaagttt-aacaagattgaaatctaatgaagtaatcttttatgttgaattatgattttactttgtg |
73 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| | ||||| || ||||||||||||||| |||||| |
|
|
| T |
10575614 |
tttctttgtaagttttaacaagattgaaattgaatgaaatgctctttcttggtgaattatgattttaatttgtg |
10575687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University