View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14526_low_11 (Length: 239)
Name: NF14526_low_11
Description: NF14526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14526_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 21916715 - 21916542
Alignment:
| Q |
1 |
ttagacattgattttaagctcactaagcatccttatgactttttctaaagttcagcaacactattaactgaagtgagattagtgtcataacttcctccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21916715 |
ttagacattgattttaagctcactaagcatccttatgactttttctaaagttcagcaacactattaactgaagtgagattagtgtcataacttcctccga |
21916616 |
T |
 |
| Q |
101 |
ttacgggaaaataagaaggcttctttaatgatcatgaaacaacaatataattatgaaaagttgaaccctagcatgca |
177 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21916615 |
ttacgggaaaat---aaggcttctttaatgatcatgaaacaacaatataattatgaaaagttgaaacctagcatgca |
21916542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 21916531 - 21916482
Alignment:
| Q |
172 |
catgcaaaggaataaaagcagctgcatttgtcttttcttcatggttaagt |
221 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21916531 |
catgcaaaggaaaaaaagcagctgcatatgtcttttcttcatggttaagt |
21916482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University