View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14526_low_17 (Length: 207)
Name: NF14526_low_17
Description: NF14526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14526_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 10371228 - 10371055
Alignment:
| Q |
18 |
gaattttctattttaagcccttgatttttctgcaaaagttacagacagacaaaataaatctatctcgaattcttgtcactaaatttagagacagatgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10371228 |
gaattttctattttaagcccttgatttttctgcaaaagttacagacagacaaaataaatctatctcgaattcttgtcactaaatttagagacagatgttt |
10371129 |
T |
 |
| Q |
118 |
tattttacaccattgattttaattaacagttaaattttctagtaattgttctacttgaaccctatttgaattcat |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10371128 |
tattttaca-cattgattttaattaacagttcaattttctagtaattgttctacttgaaccctatttgaattcat |
10371055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 104
Target Start/End: Complemental strand, 10371274 - 10371234
Alignment:
| Q |
64 |
agacaaaataaatctatctcgaattcttgtcactaaattta |
104 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10371274 |
agacaaaataaatctatctcaaattcttgtcactaaattta |
10371234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University